XMRV - CFS - AMPLIGEN

[Guest guest]

http://www.drlapp.net/meLetterMar2011.htm

HUNTER HOPKINS CENTER

Hunter-Hopkins ME-letter

March 2011

Hunter-Hopkins Center, P.A.

7421 Carmel Executive Park Drive, Suite 320

Charlotte, North Carolina 28226

Tel. · Fax.

Contents

XMRV & AMPLIGEN

A Report from the 9th Hemispherx Biopharma

Investigators Meeting

March 3-6, 2011

*Gene Sequencing in Persons with CFS

*XMRV Subset Analysis and Ampligen Treatment

*What Is Ampligen?

Gene Sequencing in Persons with CFS

Fallick, our research coordinator, and I have just

returned from the 9th Investigators Meeting sponsored by

Hemispherx Biopharma, makers of Ampligen and Alferon.

This was perhaps the most exciting of these meetings that

I have attended, and I suspect that information relayed this

past week to us will change the field of medicine forever.

I want to share that information with you.

Recall that Lombardi, Mikovits, et alia published a paper in the

October 2009 Science journal describing a novel retrovirus in

67% of 101 patients with CFS, usinga PCR (polymerase chain

reaction) test.

By checking for antibodies, viral protein, and direct viral

culture they were able to demonstrate this virus in 95-98% of

PWCs (persons with CFS).

This virus was called XMRV because of its special

characteristics: Xenotropic because it first developed in

another animal species but now infected only humans; Murine

because it first developed in mice; and RetroVirus because it

replicated backwards unlike most other viruses.

In fact, XMRV was related to a family of murine leukemia

viruses, or MLVs.

The Science paper was followed by several other reports that

the virus was not found in other cohorts, and confidence in the

Lombardi-Mikovits report was waning.

Then Drs. Lo and Alter published a 2010 paper that identified

by PCR a similar retrovirus in 86.5% of persons with CFS that

they had studied.

The viruses that they identified were MLVs, only 2-3 base pairs

(.00025 %) different from Lombardi's XMRV.

This difference has been explained as a " shift " in the genome

attributed to time and distance. That is, over time viruses

tend to mutate slightly, and it is not exceptional for viruses

from one geographical region (Lombardi/Mikovits on the West

Coast) to differ slightly from those in another region (Lo/Alter,

East Coast).

This was seen, for example, in the 2009 swine flu epidemic

where over 50 different strains of H1N1 were identified from

Hong Kong, Singapore, Malaysia, etc.

There are two retroviruses thought to be pathogenic in man:

HTLVHuman T-Lymphotrophic Virus(4 strains but only 1 is

harmful to man)

HIVHuman Immunodeficiency Virus(2 strains but only one

causes AIDS)

And now we have to add MRVs or MLVs (Murine Retroviruses or

Murine Leukemia Viruses) to the list. There are several strains

of MLVs of which XMRV is one strain.

Which strains are pathogenic in man has not yet been

determined, although XMRV has been linked to familial

prostate cancer at the least.

Let's turn for a second to a schematic representation of DNA

and XMRV. DNA is made up of two twisted strands of nucleic

acids strung together like beads. Only 4 nucleic acids are

involved:Adenine, Cytosine, Guanine, and Thymine – or A,C.G

and T – and their pattern along a single strand of DNA might

look like :

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

XMRV is an RNA virus, or strand of nucleotide sequences very

much like a single strand of DNA. Sections of each strand are

named for their specific functions. A strand of XMRV may be

represented as :

5' |Text Box: LTRUSgagpolenvU3LTR| 3'

Notice that there is a head ( " five prime " ) and a tail ( " three

prime " ) and both endsare marked by a section called the

" long terminal repeat " or LTR.

Most viruses replicate themselves startingfrom the 5'end to

the 3' end.Retroviruses, however, use " reverse transcriptase

(RT) " to replicate backwards (retro) inside a host cell to form a

strand of DNA.This strand then incorporates itself into the

host's own genomic DNA by an enzyme called " integrase. "

Thus human DNA +XMRV ends up looking like:

ACGTACGTACGTACGTLTRUSgagpolenvU3LTRCGTACGTACGTACGTACGT

This new combination DNA is called a " chimera. " Now human

DNA contains millions of nucleotides, and XMRV only contains

about 8000 nucleotides, so the chimera is not as easy to spot

as it appears here.

Incorporated into your genome like this the virus may take

control of the cell, manufacture abnormal proteins, and– in

the case of XMRV –kill the cell.This latter event is called

" apoptosis. "

Lastly, unlike the HIV retrovirus that multiplies rapidly and

millions can be found in a single drop of blood, XMRV

replicates slowly and is present in only very small amounts in

the peripheral blood.

These characteristics of XMRV can explain several

observations:

Very few XMRV particles are found in a blood sample and it

may take multiple samples to find them

Inside the cell and/or chimera, the XMRV is relatively

protected from detection by the immune system and many

blood tests

*When PWCs are very sick their white blood cell populations

decrease (due to apoptosis)

*The XMRV particle is so small it can infiltrate virtually any

part of the body and any system

*Why researchers are finding abnormal proteins in the blood

and CSF of PWCs (proteomics)

Now, here is the most intriguing part of our Hemispherx

meeting. It took hundreds of scientists at multiple sites ten

years to map out the 3 billion nucleotides in the normal human

genome.

Dr. introduced us to Urnovitz, CEO of Chronix

Biomedical. Urnovitz revealedthat his research group is able

to map genomes at a very rapid pace.

He expects that in the near future, Chronix will be able to map

your entire genome in under six hours and for probably less

than a $100 fee.

This is StarTrek medicine!

Urnovitz went on to explain that when apoptosis occurs,

chimeras are spilled into the blood stream and can be

extracted easily by his laboratory.When his lab examined the

genomes of persons with CFS they found chimeras made up of

XMRV genes (but oddly missing their LTR regions)..

This technology is wonderful news for PWCs because ifXMRV

or MLV can be clearly shown to cause CFS, then we will have

an inexpensive and uniquemarker for the disorder!

The Chronix test is not currently available commercially, but

Hemispherx plans to explore the use of this technology in

future studies.

Subset Analysis and Ampligen Treatment

Dr. Strayer, Medical Director at Hemipsherx Biopharma,

described a retrospective study of the response to Ampligen in

subjects who were positive or negative for XMRV.

XMRV was tested at VIP Labs, which is associated with the

Whittemore- Institute, and used similar techniques as

those employed by Dr. Mikovits at the WPI.

In one study, serum from 208 subjects from a previous double

blind placebo controlled Ampligen study were analyzed for

XMRV.

About one third were positive for the virus and two-thirds were

not.

Activity monitoring demonstrated less activity in XMRV+

subjects. That is, they were less active and presumably more

ill.

Specifically, the improvement in exercise ability was monitored

in these subjects. More improvement was measured inXMRV+

subjects than in XMRV-subjects.

The table below describes the percentage of subjects who

obtained at least 25% improvement in treadmill exercise

duration at week 40 of treatment, as related to XMRV

serology:

----------------------------------------------------------------

XMRV Status``|Improved``|`Improved````|Difference

``````````````on Ampligen``with placebo``(AMP-PBO)

----------------------------------------------------------------

Pos (n=81)``````44.7%```````17.6%``````27.1%

----------------------------------------------------------------

Neg (n=127)`````34.0%```````25.7%```````8.3%

----------------------------------------------------------------

Overall``````````39%`````````23%```````15.9%

Dr. Strayer concluded that there was a 70% greater than

average exercise response in XMRV+ subjects, and a 40%

lower response in those who were XMRV-.

Medication use was monitored in all of these subjects as well.

53% of XMRV+ subjects were able to reduce their use of

symptomatic medications, while only 32% of XMRV- subjects

were able to reduce medication use.

These data suggest that subjects who are XMRV+ have an

edge in responding to Ampligen, and that Ampligen may be a

treatment for CFS.

Strayer reported plans by Hemispherx to monitor this in the

current cost recovery (AMP-511) program, and hopefully to

generate another large double blind placebo-controlled

crossover study.

What Is Ampligen?

Ampligen is a poly-nucleic acid medication that has been

studied for over two decades, but not yet FDA-approved for

treating any disorder.

It was found in the 1980's to be effective in treating Chronic

Fatigue Syndrome symptoms, and subsequently underwent

several trials in the US and abroad.

Based on these results a new drug application was filed with

the FDA in 2009, and in December of that year their Complete

Letter of Response indicated that Ampligen was " approvable "

but requested that more subjects be treated to assure safety

and efficacy.

So far over 90,000 doses of Ampligen have been administered

to over 900 subjects.

Ampligen has unique properties. It is a selective Toll Receptor

(TLR3) agonist with immunomodulatory, anti-proliferative, and

anti-viral properties. The drug:

*Increases interferon a and b

*Restores TH2 immunity to the (more normal) TH1 type

*Activates the immune response (e.g.,against HIV and

renal carcinoma)

*Increases LAK and NK Cell activity

*Induces dendritic cell maturation(thus IgA and some IgG)

*Increases macrophage activity

*Restores delayed-type hypersensitivity

*Has antiviral effects versus retroviruses, HHV6, and RNA

viruses.

This drug is administered intravenously twice weekly for at

least 6 months. Side effects are mostly flu-like in nature, and

overall the drug has been tolerated extremely well.

While Ampligen is not considered a cure for CFS, published

studies have demonstrated improvement in duration of

exercise on a treadmill and a reduction in use of concomitant

medications.

Actuarial studies suggest that Ampligen treatment saves

about $5000 per year in medical expenses. Dr. Lapp has been

involved with Ampligen studies since 1988, and our personal

experience at Hunter-Hopkins with the current AMP-511 study

has been that about one third of subjects achieve very

significant global improvement.

Ampligen is currently available only at Hunter-Hopkins and Dr.

's Lake Tahoe clinic. Dr. Bateman's Fatigue

Consultation Clinic in Salt Lake City will soon resume

treatments, and Hemispherx is planning to add several other

sites around the US, in addition to sites in Mexico and

Argentina.

For more information check out our website (www.drlapp.net

>Research> Ampligen), Clinical Trials

(http://clinicaltrials.gov >search for study NCT00215813),

and the Hemispherx Biopharma website at

www.hemispherx.net.

For application to the AMP-511 Cost Recovery Study, contact

our research coordinator, Fallick, at 704 5439692.

Because AMP-511 is a treatment protocol and not a drug

study, insurance may cover some or all of the expenses

involved.

We owe a great debt of gratitude to Dr. and

Hemispherx Biopharma for developingAmpligen – the only

proposed treatment for CFS – and supporting research in CFS

for over 22 years.I know that Dr. , his colleagues, and

his company have experienced the same kind of humiliation

and disdain that all of us involved with CFS have experienced,

and it is a testament to their courage and determination that

they have endured all these years when they could have

abandoned CFS for more lucrative areas.

This newsletter is published periodically by Hunter-Hopkins

Center, P.A., 7421 Carmel Executive Park,Charlotte, North

Carolina 28226, USA..Telephone , Fax (704)

543 8547.