XMRV - CFS - AMPLIGEN

[Guest guest]

I have attached the pdf file that Jan made for those whom are interested.

blessings

Shan

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Send an Email for free membership

~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~

>>>>> Help ME Circle <<<<

>>>> 24 March 2011 <<<<

Editorship : j.van.roijen@...

~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~

For better reading and saving, I have made a PDF version of this *XMRV &

AMPLIGEN* article.

Click on the URL below and download it to your pc:

_http://www.mediafire.com/download.php?fx8nkctvh7h85uy_

(http://www.mediafire.com/download.php?fx8nkctvh7h85uy)

~jan van Roijen

````

HUNTER HOPKINS CENTER

Hunter-Hopkins ME-letter

March 2011

_http://www.drlapp.net/meLetterMar2011.htm_

(http://www.drlapp.net/meLetterMar2011.htm)

Hunter-Hopkins Center, P.A.

7421 Carmel Executive Park Drive, Suite 320

Charlotte, North Carolina 28226

Tel. (704) 543 9692 =B7 Fax. (704) 543 8547

Contents

XMRV & AMPLIGEN

A Report from the 9th Hemispherx Biopharma Investigators Meeting

March 3-6, 2011

*Gene Sequencing in Persons with CFS

*XMRV Subset Analysis and Ampligen Treatment

*What Is Ampligen?

Gene Sequencing in Persons with CFS

Fallick, our research coordinator, and I have just returned from the

9th Investigators Meeting sponsored by Hemispherx Biopharma, makers of

Ampligen and Alferon.

This was perhaps the most exciting of these meetings that I have attended,

and I suspect that information relayed this past week to us will change

the field of medicine forever. I want to share that information with you.

Recall that Lombardi, Mikovits, et alia published a paper in the October

2009 Science journal describing a novel retrovirus in 67% of 101 patients

with CFS, usinga PCR (polymerase chain reaction) test.

By checking for antibodies, viral protein, and direct viral culture they

were able to demonstrate this virus in 95-98% of PWCs (persons with CFS).

This virus was called XMRV because of its special characteristics:

Xenotropic because it first developed in another animal species but now

infected

only humans; Murine because it first developed in mice; and RetroVirus

because it replicated backwards unlike most other viruses.

In fact, XMRV was related to a family of murine leukemia viruses, or MLVs.

The Science paper was followed by several other reports that the virus was

not found in other cohorts, and confidence in the Lombardi-Mikovits report

was waning.

Then Drs. Lo and Alter published a 2010 paper that identified by PCR a

similar retrovirus in 86.5% of persons with CFS that they had studied.

The viruses that they identified were MLVs, only 2-3 base pairs (.00025 %)

different from Lombardi's XMRV.

This difference has been explained as a **shift** in the genome attributed

to time and distance. That is, over time viruses tend to mutate slightly,

and it is not exceptional for viruses from one geographical region

(Lombardi/Mikovits on the West Coast) to differ slightly from those in another

region (Lo/Alter, East Coast).

This was seen, for example, in the 2009 swine flu epidemic where over 50

different strains of H1N1 were identified from Hong Kong, Singapore,

Malaysia, etc.

There are two retroviruses thought to be pathogenic in man:

-- HTLVHuman T-Lymphotrophic Virus (4 strains but only 1 is harmful to man)

-- HIVHuman Immunodeficiency Virus (2 strains but only one causes AIDS)

And now we have to add MRVs or MLVs (Murine Retroviruses or Murine

Leukemia Viruses) to the list. There are several strains of MLVs of which XMRV

is

one strain.

Which strains are pathogenic in man has not yet been determined, although

XMRV has been linked to familial prostate cancer at the least.

Let's turn for a second to a schematic representation of DNA and XMRV. DNA

is made up of two twisted strands of nucleic acids strung together like

beads. Only 4 nucleic acids are

involved:Adenine, Cytosine, Guanine, and Thymine =96 or A,C.G and T =96

and their pattern along a single strand of DNA might look like :

ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT

XMRV is an RNA virus, or strand of nucleotide sequences very much like a

single strand of DNA. Sections of each strand are named for their specific

functions. A strand of XMRV may be represented as :

5' |Text Box: LTRUSgagpolenvU3LTR| 3'

Notice that there is a head (**five prime**) and a tail (**three prime**)

and both endsare marked by a section called the **long terminal repeat** or

LTR.

Most viruses replicate themselves startingfrom the 5'end to the 3'

end.Retroviruses, however, use " reverse transcriptase (RT) " to replicate

backwards

(retro) inside a host cell to form a strand of DNA.This strand then

incorporates itself into the host's own genomic DNA by an enzyme called

" integrase. "

Thus human DNA +XMRV ends up looking like:

ACGTACGTACGTACGTLTRUSgagpolenvU3LTRCGTACGTACGTACGTACGT

This new combination DNA is called a **chimera.** Now human DNA contains

millions of nucleotides, and XMRV only contains about 8000 nucleotides, so

the chimera is not as easy to spot as it appears here.

Incorporated into your genome like this the virus may take control of the

cell, manufacture abnormal proteins, and=96 in the case of XMRV =96kill the

cell.This latter event is called

**apoptosis.**

Lastly, unlike the HIV retrovirus that multiplies rapidly and millions can

be found in a single drop of blood, XMRV replicates slowly and is present

in only very small amounts in the peripheral blood.

These characteristics of XMRV can explain several observations:

-- Very few XMRV particles are found in a blood sample and it may take

multiple samples to find them Inside the cell and/or chimera, the XMRV is

relatively protected from detection by the immune system and many blood tests

-- *When PWCs are very sick their white blood cell populations decrease

(due to apoptosis)

-- *The XMRV particle is so small it can infiltrate virtually any part of

the body and any system

-- *Why researchers are finding abnormal proteins in the blood and CSF of

PWCs (proteomics)

Now, here is the most intriguing part of our Hemispherx meeting. It took

hundreds of scientists at multiple sites ten years to map out the 3 billion

nucleotides in the normal human

genome.

Dr. introduced us to Urnovitz, CEO of Chronix Biomedical.

Urnovitz revealed that his research group is able to map genomes at a very

rapid pace.

He expects that in the near future, Chronix will be able to map your

entire genome in under six hours and for probably less than a $100 fee.

This is StarTrek medicine!

Urnovitz went on to explain that when apoptosis occurs, chimeras are

spilled into the blood stream and can be extracted easily by his

laboratory.When

his lab examined the genomes of persons with CFS they found chimeras made

up of XMRV genes (but oddly missing their LTR regions)..

This technology is wonderful news for PWCs because if XMRV or MLV can be

clearly shown to cause CFS, then we will have an inexpensive and

uniquemarker for the disorder!

The Chronix test is not currently available commercially, but Hemispherx

plans to explore the use of this technology in future studies.

Subset Analysis and Ampligen Treatment

Dr. Strayer, Medical Director at Hemipsherx Biopharma, described a

retrospective study of the response to Ampligen in subjects who were

positive or negative for XMRV.

XMRV was tested at VIP Labs, which is associated with the

Whittemore- Institute, and used similar techniques as those employed by

Dr.

Mikovits at the WPI.

In one study, serum from 208 subjects from a previous double blind placebo

controlled Ampligen study were analyzed for XMRV.

About one third were positive for the virus and two-thirds were not.

Activity monitoring demonstrated less activity in XMRV+ subjects. That is,

they were less active and presumably more ill.

Specifically, the improvement in exercise ability was monitored in these

subjects. More improvement was measured inXMRV+ subjects than in

XMRV-subjects.

The table below describes the percentage of subjects who obtained at least

25% improvement in treadmill exercise duration at week 40 of treatment, as

related to XMRV

serology:

----------------------------------------------------------------

XMRV Status``|Improved``|`Improved````|Difference

``````````````on Ampligen``with placebo``(AMP-PBO)

----------------------------------------------------------------

Pos (n=3D81)``````44.7%```````17.6%``````27.1%

----------------------------------------------------------------

Neg (n=3D127)`````34.0%```````25.7%```````8.3%

----------------------------------------------------------------

Overall``````````39%`````````23%```````15.9%

Dr. Strayer concluded that there was a 70% greater than average exercise

response in XMRV+ subjects, and a 40% lower response in those who were XMRV-.

Medication use was monitored in all of these subjects as well. 53% of

XMRV+ subjects were able to reduce their use of symptomatic medications, while

only 32% of XMRV- subjects were able to reduce medication use.

These data suggest that subjects who are XMRV+ have an edge in responding

to Ampligen, and that Ampligen may be a treatment for CFS.

Strayer reported plans by Hemispherx to monitor this in the current cost

recovery (AMP-511) program, and hopefully to generate another large double

blind placebo-controlled crossover study.

What Is Ampligen?

Ampligen is a poly-nucleic acid medication that has been studied for over

two decades, but not yet FDA-approved for treating any disorder.

It was found in the 1980's to be effective in treating Chronic Fatigue

Syndrome symptoms, and subsequently underwent several trials in the US and

abroad.

Based on these results a new drug application was filed with the FDA in

2009, and in December of that year their Complete Letter of Response

indicated that Ampligen was **approvable** but requested that more subjects be

treated to assure safety and efficacy.

So far over 90,000 doses of Ampligen have been administered to over 900

subjects.

Ampligen has unique properties. It is a selective Toll Receptor (TLR3)

agonist with immunomodulatory, anti-proliferative, and anti-viral properties.

The drug:

-- *Increases interferon a and b

-- *Restores TH2 immunity to the (more normal) TH1 type

-- *Activates the immune response (e.g.,against HIV and renal carcinoma)

-- *Increases LAK and NK Cell activity

-- *Induces dendritic cell maturation(thus IgA and some IgG)

-- *Increases macrophage activity

-- *Restores delayed-type hypersensitivity

-- *Has antiviral effects versus retroviruses, HHV6, and RNA viruses.

This drug is administered intravenously twice weekly for at least 6

months. Side effects are mostly flu-like in nature, and overall the drug has

been

tolerated extremely well.

While Ampligen is not considered a cure for CFS, published studies have

demonstrated improvement in duration of exercise on a treadmill and a

reduction in use of concomitant

medications.

Actuarial studies suggest that Ampligen treatment saves about $5000 per

year in medical expenses. Dr. Lapp has been involved with Ampligen studies

since 1988, and our personal

experience at Hunter-Hopkins with the current AMP-511 study has been that

about one third of subjects achieve very significant global improvement.

Ampligen is currently available only at Hunter-Hopkins and Dr. 's

Lake Tahoe clinic. Dr. Bateman's Fatigue Consultation Clinic in Salt Lake

City will soon resume treatments, and Hemispherx is planning to add several

other sites around the US, in addition to sites in Mexico and Argentina.

For more information check out our website (_www.drlapp.net_

(http://www.drlapp.net) >Research> Ampligen), Clinical Trials

(_http://clinicaltrials.gov_ (http://clinicaltrials.gov) >search for study

NCT00215813), and the

Hemispherx Biopharma website at _www.hemispherx.net_ (http://www.hemispherx.net)

..

For application to the AMP-511 Cost Recovery Study, contact our research

coordinator, Fallick, at 704 5439692.

Because AMP-511 is a treatment protocol and not a drug study, insurance

may cover some or all of the expenses involved.

We owe a great debt of gratitude to Dr. and Hemispherx

Biopharma for developing Ampligen -- the only proposed treatment for CFS --

and supporting research in CFS for over 22 years.I know that Dr. , his

colleagues, and his company have experienced the same kind of humiliation

and disdain that all of us involved with CFS have experienced, and it is a

testament to their courage and determination that they have endured all these

years when they could have abandoned CFS for more lucrative areas.

This newsletter is published periodically by Hunter-Hopkins Center, P.A.,

7421 Carmel Executive Park,Charlotte, North Carolina 28226, USA..Telephone

(704) 543 9692, Fax (704) 543 8547.

~~~~

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Send an Email for free membership

~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~

>>>>> Help ME Circle <<<<

>>>> 24 March 2011 <<<<

Editorship : j.van.roijen@...

~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~:~